circad | circRNAs associated with diseases

chr18:35610871-35613502+
Gene	Paip2	Organism	Human
Genome Locus	chr18:35610871-35613502:+	Build	hg19
Disease	Intestinal injury and repair	ICD-10	Injury of unspecified intra-abdominal organ (S36.9)
DBLink	Link to database	PMID	29991023
Experimental Method
Sample Type	Tissues	Comparison	Day 3.5 post-radiation, the mice were sacrificed and their jejuna harvested and frozen at -80�C and matched controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACGCTGTTTCCAAGAAATGC Reverse ACTGCTGCGACTTGGATCTT	Statistics	Fold Change : Upregulated,2.0825754 pvalue : p=0.0465572
Citation
Lu, Q, Gong, W, Wang, J, Ji, K, Wang, Y, Xu, C, Liu, Y, He, N, Du, L, Liu, Q (2018). Identification of Circular RNAs Altered in Mouse Jejuna After Radiation. Cell. Physiol. Biochem., 47, 6:2558-2568.